                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-19.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-19.10 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-19.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTTACATTGGTTTTAAAGTTATGATGAGCGGTATTGAACTTGAACATCAACTTGCTC
CCAATTTTGAGCTGGAAACTGTGGACCCCCTCCCTGGTTTCGGCTTCGGGAACAAAAC
GGTCGTCTTCTTTGTGTTTGGTATCAGCGAGGTTACTCAGTAAtctcaatcatgagtctcagccccat
cccctccgcgggctgagactgtttttttctcttaaaaggcctgcggatccccctccttgcaggcctttttcttttttaaaattcaaaaattcgaaattaa
atgccatggttgattaATG

    Bd0073 Gene: Bd0073     GI: 42521719     BI number: Bd0073     GOG: -------     Description: polysaccharide deacetylase-related protei             t           t  t           g  t           t  t           c  t            at            gc        cc            at       c  c cc        gc       t  c c  t      |  t       at c  c      |  t       gc t  c      |  a       gc a  g      |  a      |  t c  c      |  a      |  t cg       |  a       cg cg        tg        gc cg        cg        ta gc        gc        cg at        gc        cg cg        gt        gc ta        cg        gc cg        gc        at ta        cg        at gc        cg        at at        ta        at                         tcttttttaaaattcaaaaattcgaaattaaatgccatggttgattaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.40 kcal/mol Antiterminator: Size=43 nt.     Delta G=-19.10 kcal/mol Anti-antiterminator:   Size=32 nt.     Delta G=-17.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCTTACATTGGTTTTAAAGTTATGATGAGCGGTATTGAACTTGAACATCAACTTGCTC CCAATTTTGAGCTGGAAACTGTGGACCCCCTCCCTGGTTTCGGCTTCGGGAACAAAAC GGTCGTCTTCTTTGTGTTTGGTATCAGCGAGGTTACTCAGTAAtctcaatcatgagtctcagccccat cccctccgcgggctgagactgtttttttctcttaaaaggcctgcggatccccctccttgcaggcctttttcttttttaaaattcaaaaattcgaaattaa atgccatggttgattaATG     Bd0073 Gene: Bd0073     GI: 42521719     BI number: Bd0073     GOG: -------     Description: polysaccharide deacetylase-related protei             t           c  g           a  t           g  t           a  t            gt            tt            ct            gt cc       |  c c  t      |  t       cc c  c      |  c      c  c t  c      |  t      t  c a  g      |  t       at c  c      |  a       gc cg        ga        gc cg        ga       |  t cg        ca       |  t gc        gg        cg at        cg        gc cg        cc        ta ta        tc        cg cg        ct        cg ta        cg        gc gc        cc        gc                         tttttcttttttaaaattcaaaaattcgaaattaaatgccatggttgattaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-19.10 kcal/mol Antiterminator: Size=45 nt.     Delta G= -8.10 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G= -9.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCTTACATTGGTTTTAAAGTTATGATGAGCGGTATTGAACTTGAACATCAACTTGCTC CCAATTTTGAGCTGGAAACTGTGGACCCCCTCCCTGGTTTCGGCTTCGGGAACAAAAC GGTCGTCTTCTTTGTGTTTGGTATCAGCGAGGTTACTCAGTAAtctcaatcatgagtctcagccccat cccctccgcgggctgagactgtttttttctcttaaaaggcctgcggatccccctccttgcaggcctttttcttttttaaaattcaaaaattcgaaattaa atgccatggttgattaATG     Bd0073 Gene: Bd0073     GI: 42521719     BI number: Bd0073     GOG: -------     Description: polysaccharide deacetylase-related protei   C T  T        C G  T      T  A C  C       CG T  T       AT GT        TA GT        TA CG        Gt AT        Gc |  G       At AT        Gc AT       |  a       cc AT       |  a      c  t CG       |  t      c  c |  G      C  c      t  c |  T      G  a      a  g A  A       At       c  c AT        Cg        cg GC        Ta        cg |  A      |  g       cg G  G      |  t       gc GC       |  c       at CG       |  t       cg TA       |  c       ta TG       A  a       cg CG        Tg        ta GT        Gc        gc GT        Gc        at                         gtttttttctcttaaaaggcctgcggatccccctccttgcaggcctttttcttttttaaaattcaaaaattcgaaattaaatgccatggttgattaATG     ..................................................................................................................