                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATTATCATCAACAGTTTTGGCAATGATAAATGACAATAGAAACAGGGCTGAAAACA
ACCAATGAAAAAGCCGTGTCGGCAAATCGTATATCAAAGTGGACCGCATcttacgcctcctttt
gaattctgcgcttctgaagctttaaaatcgtctctttttaaaaagtcgtccattgggcaaatggcctatccggcctttattccaacacttagggcattca
gaccattttcaatcttcggcgaatagcgatactgagtctaagcgatagggaattaatcccatcaaaaggagaaaaaacATG

    Bd0091 Gene: Bd0091     GI: 42521736     BI number: Bd0091     GOG: COG5591     Description: conserved hypothetical protei ta t  a ta ta ta         a cg       a  t t  t      a  g c  |       cg t  |       gc gc        gc cg        gt t  t       ta a  c      t  t a  c      a  c a  a      c  | a  t      c  | t  t      t  | tg        gc tg        cg cg        tg gc        gc             ctttattccaacacttagggcattcagaccattttcaatcttcggcgaatagcgatactgagtctaagcgatagggaattaatcccatcaaaaggagaaaaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5591 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................