                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-22.00 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -8.37 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACAAATCCAAGCTTGCAAAAGAACTGGGTATCAGCCGCGCGGGTCTTATCATGAAG
GTCGAAAAGTACGGCCTGGATAAGCGTAAACTGGCGCGCTAAaaagggcaccgaccctaaaagaattac
ctaaatgatcgaaacttagtgggctttaagagcaaatcttaaagcccactttttttgccaaaaacgggctatccttctgaatatactcaataatttaaac
ccccttcggacttggcattgctcttgtagtagtgaagttccagctaggtattgtgtaaggggtacgtggttttATG

    Bd0155 --- Bd0154 --- Bd0153 --- Bd0152 Gene: Bd0155     GI: 42521791     BI number: Bd0155     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd0154     GI: 42521790     BI number: Bd0154     GOG: COG3178     Description: conserved hypothetical protein Gene: Bd0153     GI: 42521789     BI number: Bd0153     GOG: -------     Description: mannose-1-phosphate guanyltransferase Gene: Bd0152     GI: 42521788     BI number: Bd0152     GOG: COG3876     Description: putative membrane protei            ta           c  a           c  a            at            tg            ta           a  |            at            gc           a  g           a  a           a  a           a  a           t  c           c  t           c  t CT       c  a A  G      a  g        a A  G       gt       c  a A  C       cg       g  a TG        cg        at GC       a  |       gc CG        cg        at GC        gc        at AT        gt        ta A  A       gt        ta T  A       at        ta A  a      a  a       cg G  a      a  a       gc G  a      A  g       gc Tg       A  |       gc Cg        Ta        ta Cg        Cg        gc Gc        Gc        at                         ttttttgccaaaaacgggctatccttctgaatatactcaataatttaaacccccttcggacttggcattgctcttgtagtagtgaagttccagctaggtattgtgtaaggggtacgtggttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3178 Predicted phosphotransferase related to Ser/Thr protein kinases ... can be seen here [S] COG3876 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................