                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:169 nt.    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGACT-TCAATT. It has a score value of 62.92 and is shown in blue

TGGACTTTGTCATCGTGGCCTTTTCAATTTTCCTGATCATTAAAGCCGCGAACAAATT
GAAGCGGGCCGAAGAGCCCGCCCCGGTGACCACGAAAGAATGTCCAGAGTGCTGCTCA
AGCATCCCGATGAAAGCACGTAAGTGCGCTCACTGCGGAAGTGCGGTTGCTTCCTAGa
cctcttcaaattcaacgacacttcaaagcccggcccctgccgggcttttttattttctttccccgcctgtactggctttgaccgaaatctcactctgaga
cgtaaaccttTTG

    Bd0161 --- mrcA --- uvrA --- ygaD --- Bd0157 Gene: Bd0161     GI: 42521797     BI number: Bd0161     GOG: -------     Description: conserved hypothetical protein Gene: mrcA     GI: 42521796     BI number: Bd0160     GOG: COG5009     Description: penicillin-binding protein 1A Gene: uvrA     GI: 42521795     BI number: Bd0159     GOG: -------     Description: excinuclease ABC subunit A Gene: ygaD     GI: 42521794     BI number: Bd0158     GOG: COG1132     Description: ABC transporter, nucleotide binding/ATPase protein Gene: Bd0157     GI: 42521793     BI number: Bd0157     GOG: -------     Description: putative mechano-sensitive ion channe           cc          c  t           cg           gc           gc           cg           cg           cg           gc           at           at           at             tttattttctttccccgcctgtactggctttgaccgaaatctcactctgagacgtaaaccttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5009 Membrane carboxypeptidase/penicillin-binding protein ... can be seen here [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:170 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.80 kcal/mol Antiterminator:    Distance from promoter:133 nt. Size=65 nt.     Delta G=-14.02 kcal/mol Anti-antiterminator:    Distance from promoter:109 nt.    Size=58 nt.     Delta G=-10.83 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TGGACT-TCAATT. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGACTTTGTCATCGTGGCCTTTTCAATTTTCCTGATCATTAAAGCCGCGAACAAATT GAAGCGGGCCGAAGAGCCCGCCCCGGTGACCACGAAAGAATGTCCAGAGTGCTGCTCA AGCATCCCGATGAAAGCACGTAAGTGCGCTCACTGCGGAAGTGCGGTTGCTTCCTAGa cctcttcaaattcaacgacacttcaaagcccggcccctgccgggcttttttattttctttccccgcctgtactggctttgaccgaaatctcactctgaga cgtaaaccttTTG     Bd0161 --- mrcA --- uvrA --- ygaD --- Bd0157 Gene: Bd0161     GI: 42521797     BI number: Bd0161     GOG: -------     Description: conserved hypothetical protein Gene: mrcA     GI: 42521796     BI number: Bd0160     GOG: COG5009     Description: penicillin-binding protein 1A Gene: uvrA     GI: 42521795     BI number: Bd0159     GOG: -------     Description: excinuclease ABC subunit A Gene: ygaD     GI: 42521794     BI number: Bd0158     GOG: COG1132     Description: ABC transporter, nucleotide binding/ATPase protein Gene: Bd0157     GI: 42521793     BI number: Bd0157     GOG: -------     Description: putative mechano-sensitive ion channe            ac           c  t            at            gc TC       |  a T  C      c  a C  T      a  a G  A      a  g TG       c  c Ta       t  c Gc       t  c Gc        ag C  t       ag G  |       ac T  |       cc Gc       t  c At       t  c At        ct Gc        t G  a       c C  a       c G  a       a T  t       G C  t      | A  c      |         cc C  a      A        c  t T  a       T        cg C  |       C        gc Gc       C         gc Cg       T         cg |  a      T  |       cg Gc       C  |       cg Ta        G        gc Gc        T        at At        T        at                         ttttattttctttccccgcctgtactggctttgaccgaaatctcactctgagacgtaaaccttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5009 Membrane carboxypeptidase/penicillin-binding protein ... can be seen here [V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here     ..................................................................................................................