                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTTCGTAGGCCGGGAAGGATTGCCCCAGACCCCATATACGGGCCATAAGCAGTAAAA
TACCAAGGATAAGGAAGCTGACAGCGGTAATGAAAAGGATTCTCATAGGACCTTCGTA
TAGCATcctaagactttgaaatcagcacattttttcaaaacagaaggaaagattcctgtcataaccttaaatacgttaaaattaggcgtatttcgc
cttgtttttcaattggctttctattagatagaaggcgacgccgtgtccgcagaggaccctctgagggcgccggtgaagggaaccttacATG

    Bd0184 --- sufB --- sufC --- sufD --- csdB --- NifU --- Bd0191 Gene: Bd0184     GI: 42521817     BI number: Bd0184     GOG: COG1959     Description: hypothetical protein with transcriptional regulator domain Gene: sufB     GI: 42521818     BI number: Bd0186     GOG: COG0719     Description: ABC transporter permease Gene: sufC     GI: 42521819     BI number: Bd0187     GOG: COG0396     Description: Iron-regulated ABC transporter ATPase subunit SufC Gene: sufD     GI: 42521820     BI number: Bd0188     GOG: COG0719     Description: Transport protein involved in the [Fe-S] cluster assembly. Gene: csdB     GI: 42521821     BI number: Bd0189     GOG: COG0520     Description: - Gene: NifU     GI: 42521822     BI number: Bd0190     GOG: -------     Description: putative nitrogen-fixing protein NifU Gene: Bd0191     GI: 42521823     BI number: Bd0191     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic   a a  t a  t a  a tg         t tg       a  t gc       t  t cg        gc at        cg ta        gc at        gc at        at             tgtttttcaattggctttctattagatagaaggcgacgccgtgtccgcagaggaccctctgagggcgccggtgaagggaaccttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1959 Predicted transcriptional regulator ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................