Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=72 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATcccgtctcctcgtgcaagttccgctttatactcgacagaaaattcgcatcaacaagtatgagattaccaagggaatattccaccgcctcggtgga
gatgttccttttgtggtttggatgaaacgttcgctgaggttccgggcgctctttgttgctgtgggagcggatttgcggcggttaccattgaatggctgta
ataagccgcggttggatggaccctctgatgatctggtacggaacacttgcctggcacagtcattgatcttcaggtctttgcaaacttaaacaggagataa
caATG

    Bd0204


Gene: Bd0204     GI: 42521834     BI number: Bd0204     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


           aa
          g  a
          a  a
          c  t
           at
           gc
           cg
          |  c
          |  a
          |  t
          |  c
          |  a
          |  a
          |  c
          |  a
           ta
           cg
           at
           ta
           at
           tg
           ta
          |  g
          |  a
          |  t
          |  t
          |  a
 aa       |  c
c  g      |  c        c
g  t      |  a      c  t
t  t       ta        gc
 gc        cg        cg
 Gc       g  |       cg
 Tg        cg        at
A  c       cg        cg
a  t       ta        cg
c  |       ta        ta
 at        gt       |  g
 at       |  a       ta
 ta        at        at
 at        at        tg
|  a      c  c       at
 gc        gc        at
 at        ta        gc
 gc        gc        gc
                        ttttgtggtttggatgaaacgttcgctgaggttccgggcgctctttgttgctgtgggagcggatttgcggcggttaccattgaatggctgtaataagccgcggttggatggaccctctgatgatctggtacggaacacttgcctggcacagtcattgatcttcaggtctttgcaaacttaaacaggagataacaATG


    ..................................................................................................................