                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-11.71 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGGCCTCGACAGCGCTGTCGACCAGAGCTGTCGGAAGAACCACTTCAATTTTTATC
TTTGGGAGAAAGTCGACAACGTATTCGGCGCCTTTGTAAACCTCAGTGCGCCCTTTTT
GTCGACCGAAACCACGAACTTCTGAGACAGTGATCCCTTCAACGCCGACCTCTGAGAG
AGCATCGACCACATCATCAAGCTTGAAGGGTTTTATGATTGCCTCAATTTTTTTCATc
tacttctttgttcgggaaaacgaaattctaaatttagattttcaaaaggatagcaaaggaactcaggaATG

    Bd0269 --- cspR Gene: Bd0269     GI: 42521893     BI number: Bd0269     GOG: -------     Description: conserved hypothetical protein Gene: cspR     GI: 42521894     BI number: Bd0271     GOG: COG0219     Description: rRNA methyltransferas   C A  C A  A GC AT AT GC |  A |  A       CG |  T      A  T G  T      A  A C  T      C  T T  T       AT GT        GC TA        CG C  T       TG GC        GC AT       A  G GT       A  | AT       A  | CG       G  |        A CG       A  |      A  C |  G       GC       A  C |  A       GC       T  T |  G       GT        GC |  A      T  T       TA |  A      T  T       TG |  A      T  |      T  T |  G      C  |      C  | AT        TG        CG GC        AT        GC CG        TA        CG TA        TA        GC GC        TA        GC                         CTTTTTGTCGACCGAAACCACGAACTTCTGAGACAGTGATCCCTTCAACGCCGACCTCTGAGAGAGCATCGACCACATCATCAAGCTTGAAGGGTTTTATGATTGCCTCAATTTTTTTCATctacttctttgttcgggaaaacgaaattctaaatttagattttcaaaaggatagcaaaggaactcaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0219 Predicted rRNA methylase (SpoU class) ... can be seen here     ..................................................................................................................