                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGCCCCCGGAGGTGGTGGATAAGTTCCCTGTCTTTGCGCGCAGTCCGGACGATTCA
CACCCGAGGCATGGATCTCGATCAGCACTTCGCCGATGGCAGGTTCAGGCTTGGTTCG
TTCGGTGATTTTTAAAACTTCAGGTCCGCCGGGTTGGGTGATTTCAACTGCACGCATg
aaagtgactccttctgggaataattcaaaatgcgcccctgtttttccgtcgtcaagactttgaaactgggccataggccagttgccgggcgttaagcccg
aagaccagaaacacgataagatttgcATG

    Bd0304 Gene: Bd0304     GI: 42521927     BI number: Bd0304     GOG: -------     Description: similar to cell wall-associated hydrolase AC C  C A  C CG TA TG A  G G  C                 CA C  A        T       T  G A  |      C  T       TG G  |      A  C       GC GT        CG        GT CG        GC        AT CG       A  C       CG TA        CG       |  G GT        TA       |  T A  C       AT        GT C  T      |  G       GC GC       G  G       TG CG       C  C      |  T |  A       TA        AT |  T       CG        GC |  C       TG        CG G  A       AT        CG CG        GT        GT GC        GC        CG TA        TA        TA                         TTTTTAAAACTTCAGGTCCGCCGGGTTGGGTGATTTCAACTGCACGCATgaaagtgactccttctgggaataattcaaaatgcgcccctgtttttccgtcgtcaagactttgaaactgggccataggccagttgccgggcgttaagcccgaagaccagaaacacgataagatttgcATG     ..................................................................................................................