Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTTCTGAAGAAGACATGAAAAAGGCCTTCGAGATCGGCGCGGATGACTACATCAAAA
AGCCATTCGACGTTGAAAAGCTGAAAAAAACCGTGGAAACGCTTTTGAAGCTGAATCC
GTAAccggaacgaaaatagcttaaaaaattgggacccctcagtgagtgattgctgagggtttttttattacagaccaaagttctgtctcaattcggg
aacacaggccgtttccatactttcccaatacttcttgcagaaaatagtgaacgtggccccctttttaacgatagaattaaaggactcATG

    Bd0375 --- Bd0376


Gene: Bd0375     GI: 42521989     BI number: Bd0375     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica
Gene: Bd0376     GI: 42521990     BI number: Bd0376     GOG: COG4935     Description: putative extracellular serine proteas


 ac        tg
g  c      g  a
 gc        at
 gc        gt
t  t       tg
t  c       gc
a  a       at
a  g       cg
a  |       ta
a  |       cg
a  |       cg
 at        cg
 tg       c  t
 ta        at
 cg        gt
 gt        gt
            tttattacagaccaaagttctgtctcaattcgggaacacaggccgtttccatactttcccaatacttcttgcagaaaatagtgaacgtggccccctttttaacgatagaattaaaggactcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG4935 Regulatory P domain of the subtilisin-like proprotein convertases and other proteases ... can be seen here

    ..................................................................................................................