                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-13.70 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCCAGAAGTTCTCGGACAAACAAATCCGCATCATGCAGGATTTCAACAAACGCCT
GGCCGATCCAAGTCTATTTGAATCCGCCATCATCCCCACCTTCGAAGGCCTCTACATA
GCCCTCAAAAAATAAaaggtgcctggtgactttttacacctacgccgcgttatctcattctgagacagcggcttggccctgcctttgct
ttactccttagttatcaggtccgcctcgaatcacgaggctccggcccgcggaagtgccgtttttcagtactcacgcgtaaagaaaaggagcagttATG

    Bd0382 Gene: Bd0382     GI: 42521996     BI number: Bd0382     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic   t c  c a  c t  t t  t ta cg gt t  t t  a        t t  t      a  c c  |      a  a c  |       gc gc        cg ta        ta cg        cg        ga cg        cg       g  a c  t       gc        cg gc       |  t       gt gc       |  c      c  | t  |      c  c      c  | t  |       cg        cg cg        tg        gc gc        gc        gc gc        gc        cg                         tttttcagtactcacgcgtaaagaaaaggagcagttATG     ..................................................................................................................