                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=2 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-10.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCACCTGCAAAGCCTTTTTCTGCAGGGCTTGTTCAGCTTGGGCAAATTGTTGCAATTG
TTCCGGCGTCAGAAAATCAATACTGACAGTCTCTTTCGGGGGGGCTTCTTCTTTAAGC
AAACTCGTGATGTAAAAGCCTCCTACGACTACAAAGTGCAGAAGCAGGGACAGCACAA
TATATTTTCTGAAAGTCGGTGACTTCTTCATaagacctcacccctttctatcggtattatgacacttgaaattgaga
agatggtgagctggactcaaagattgcgacccaagtctagggccagactTTG

    Bd0397 --- Bd0398 Gene: Bd0397     GI: 42522011     BI number: Bd0397     GOG: COG0631     Description: protein phosphatase Gene: Bd0398     GI: 42522012     BI number: Bd0398     GOG: COG0739     Description: cell wall-binding protein associated metalloendopeptidas   T T  G GC TA TA A  | AT AT CG GT GT GC T  C TG CG GC A  G C  T T  | T  | G  | T  | T  |       TC C  |      A  A G  |      A  A G  |      A  T G  |      A  A        C A  |       GC       T  G C  |       AT       T  G GC        CG        TG TA        TA        CG CG        GC        TG TA       |  A       CG TA        CG        TG TA        GT        GC TA        GC        AT                         TCTTCTTTAAGCAAACTCGTGATGTAAAAGCCTCCTACGACTACAAAGTGCAGAAGCAGGGACAGCACAATATATTTTCTGAAAGTCGGTGACTTCTTCATaagacctcacccctttctatcggtattatgacacttgaaattgagaagatggtgagctggactcaaagattgcgacccaagtctagggccagactTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0631 Serine/threonine protein phosphatase ... can be seen here [M] COG0739 Membrane proteins related to metalloendopeptidases ... can be seen here     ..................................................................................................................