Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G=-11.54 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTAAAAATCCTGTTTTATAAAGTTTTTATTCCAGTGAAACTCGCGCCAGTAGCGGC
TTTCGCTCAAAAAGTAAAACTGCGAATTTTTCCTCGCGAAAGATGCATAGTTGTGAAT
TGTCTGCTGTTTATTGGTCCAAAATAAaaaatgaaaacgacaattgacgcaaaagctccatttgggtgtcaaacgctgga
tgaaggtctaggtttacaaatattttacgttacacaaccagacctcggtcataagatttttcgcaaacctaaccaaattttgaacttatatataaggagt
tcatGTG

    Bd0425


Gene: Bd0425     GI: 42522038     BI number: Bd0425     GOG: -------     Description: conserved hypothetical protei


 AA
A  A
C  T
C  A
T  A
G  a
G  a
 Ta
 Ta
 At
 Tg
 Ta
 Ta
G  a
T  a
C  c
G  |
T  |
 Cg
 Ta
 Gc
 Ta
 Ta
 At
 At                  aa
|  g                g  g
|  a       tc        tg
 Gc       c  c       at
 Tg       g  a       gc
 Gc        at        gt
 Ta        at        ta
 Ta        at        cg
G  a      |  g      g  |
A  a      a  g       cg
T  |       cg        at
A  |       gt        at
 Cg        cg        at
 Gc        at       c  |
T  |       gc        ta
 At        ta        gc
 Gc        ta        ta
                        aatattttacgttacacaaccagacctcggtcataagatttttcgcaaacctaaccaaattttgaacttatatataaggagttcatGTG
    ..................................................................................................................