Gene putatively regulated by attenuation in B_bacteriovorus
Characteristics of the secondary structures
Terminator: Distance to gene:70 nt. Distance to run of Ts=0 nt. Size=30 nt. Delta G= -8.00 kcal/mol
Antiterminator: Size=48 nt. Delta G= -7.32 kcal/mol
Anti-antiterminator: Size=40 nt. Delta G=-15.30 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CGCGAGGAAAAATTCGCAGTTTTACTTTTTGAGCGAAAGCCGCTACTGGCGCGAGTTT
CACTGGAATAAAAACTTTATAAAACAGGATTTTTAGGCACTGGGGTTCGGTAACAAAG
TCCTGTGGAGTTGAAGTCACagtcctgatgcgtctttcgactttttaggtgggttgaaaacgtatcgaaaatttttgttgttgat
cttggacctggtcctcattagcattttttgtgtaaacgattaaagcttttaatggatttaaaagttcataagattgcaacgaaacgaaaggatgcaacaA
TG
Bd0427 --- Bd0428
Gene: Bd0427 GI: 42522040 BI number: Bd0427 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critica
Gene: Bd0428 GI: 42522041 BI number: Bd0428 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critic
a
a a
g a
c t
t t
a a t
t g t t
t g gt
t t cg
tg at
tg at t
cg a g c g
at at cg
gt gt at
cg tg gc
ta ta gc
ta gt t t
ta gc t c
c | gt c |
ta | t ta
gc | g at
cg | g gt
gt ta ta
ta gc tg
at gc gc
gc at ta
ttttttgtgtaaacgattaaagcttttaatggatttaaaagttcataagattgcaacgaaacgaaaggatgcaacaATG
..................................................................................................................