                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-15.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACAGTCTATTTCCGTTCCATCATCCATCTTGATTCTGAGTATTCCTGAAACATGGTAT
TGAAAATGCGGAGCTTCGCAGCTGTCCGTTTGCGCGATCTCTTTCACTGATTTGGACC
AGCGCCAGCCTGGCTGCAAGATCGCCCGTCCGACAACAGCTTCCCCGAAGCGAACCAG
CTCCAGACGGCCATTGGGAAACTCACGAACCTCATCGGCAGAACTAAAATTCAGCGAC
TTAAGAGTTCCGCTGACCTTTGCAAAGACGGTCGAAGGATTCGGCTTCTGCGGCGAAG
CGGAAGTTTGTTG

    Bd0438 --- Bd0437 --- Bd0436 --- Bd0435 Gene: Bd0438     GI: 42522048     BI number: Bd0438     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd0437     GI: 42522047     BI number: Bd0437     GOG: -------     Description: hypothetical protein Gene: Bd0436     GI: 42522046     BI number: Bd0436     GOG: COG1680     Description: putative penicillin-binding protein Gene: Bd0435     GI: 42522045     BI number: Bd0435     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic AA T  G TA CG AT |  T |  C GC CG GC         G AT       G  A CG        AT TA        AT T  C       GC A  C       CG AT        TG AT        GC AT        GT TG       C  | |  C       AT |  A       GC |  A       AT C  A      A  G A  G      A  | A  A      C  | G  C      G  | A  G      T  | CG       T  |       CG GT       T  |      G  A GC       C  |      G  A CG       C  |       CG TA       A  |       GC A  |       GC        TG C  |       TG        CG TA        CG        TA CG        GC        TA CG        CG        CG                         TTTGTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1680 Beta-lactamase class C and other penicillin binding proteins ... can be seen here     ..................................................................................................................