                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCACAGGATGGTACAAATCAAAGCCGTTATTCCATGCCGTTCTTCATGCACCCGCAT
CCGGAGGCAATGCTAAGCTGCTTGCCATCTTGTAAAGGGACAGGTGCGAAGTACGCTG
ATATTACTGGACAGGATTTCTTGATGCAGCGACTGCGCGAGATTGGTCTGTTAAAGTA
Agcccaaacttgtcaccacagttgaaatgacttcaagaaagggatccacacggatccctttcttgcgttttgggccctggggccactagaacaaagtcac
ctgcgaatttcacatgagggggaatcATG

    Bd0453 --- Bd0454 --- Bd0456 Gene: Bd0453     GI: 42522062     BI number: Bd0453     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd0454     GI: 42522063     BI number: Bd0454     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd0456     GI: 42522064     BI number: Bd0456     GOG: -------     Description: putative lactoylglutathione lyas   A A  A T  G T  T G  A TA         a Cg       a  a T  c      g  t Gc        tg Gc        ta Ta        gc Ta        at A  a      c  t Gc       a  | At       c  | Gt       c  | Cg       a  | Gt       c  | |  c      t  | |  a       gc |  c       ta        ca |  c       ta       a  c C  a       cg        cg Gc       a  a       cg Ta       a  a       ta Cg       a  a       at At        cg        gc Gt        cg        gc Cg        cg        gc                         tttcttgcgttttgggccctggggccactagaacaaagtcacctgcgaatttcacatgagggggaatcATG     ..................................................................................................................