                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-21.20 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAAAAGTTCTACGAAGTGGCGCTGCAATCCGGCGGCCAGGATAACGGTGCGCCGGG
CGAGCGTCCTTACCACCCGGGTTATTATGCGGCCTTTGTGCTGGATCCAGACGGAAAC
AACATCGAAGCGGTCTTCCATGGTCCGGCGAAAAAGTCGGCGGAGTCGGTGAAGATCA
CCTTCTAAatgacaggcgcatgttgagatgcatgaagggctctttgctttggcaaagggccttttgctttcttgagggtgacaatgctggattc
taagatgagttgtcacacccaaggaggttttcATG

    Bd0457 Gene: Bd0457     GI: 42522065     BI number: Bd0457     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic   G A  A A  T GC TA GC GC C  T                 tt T  T                t  g GC                  cg AT                  gc G  A                 ta G  A       ag        ta C  a      g  a       ta G  |      t  t       cg Gt        tg        tg Cg        gc        cg Ta        ta        gc Gc        at        gc A  a       cg        gt A  g      |  a       at A  g      |  a       at A  |      |  g      g  | A  |      g  g      t  | Gc        cg        at Cg        gc        cg Gc        gt        gc                         tttcttgagggtgacaatgctggattctaagatgagttgtcacacccaaggaggttttcATG     ..................................................................................................................