                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:209 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agacacgtaatatcgctaagttgttgaaaccatagtaggttttaaatacttgtgagcaaaaaggcctagggcagagatgccgggccttttttcgtttcta
aagacgggggcgttttgccaacgttagggacgtctttctctttgtagtggccgctgtcagcctgaagcgcccagtcaattctactagattttaattgagt
ctccctagatttaggtccagatttatacatgtattcaccatcatagcgccttggtgtgtctaaaataagggtgaatcctgagtaccttttgggaggatga
ATG

    Bd0543 Gene: Bd0543     GI: 42522143     BI number: Bd0543     GOG: COG1699     Description: putative transmembrane protei            ga           t  g            gc ag        ta t  t       ta a  a      c  a cg       a  | cg       t  | Gt       a  | T  t      a  | At       a  | at        ta        ag |  a       ta       g  a g  a       tg        at t  a       tg        cg a  t       gc        gc g  a       gc        gc gc        at       g  | at        ta       a  | gt       g  g       tg g  g      a  |       cg gt       t  |       cg tg       a  |       gc ta        cg        gc tg        cg        at                         tttttcgtttctaaagacgggggcgttttgccaacgttagggacgtctttctctttgtagtggccgctgtcagcctgaagcgcccagtcaattctactagattttaattgagtctccctagatttaggtccagatttatacatgtattcaccatcatagcgccttggtgtgtctaaaataagggtgaatcctgagtaccttttgggaggatgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1699 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................