                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTGTCTATGAGGCCCGCCCGACCCAATGCCGAACCTGGCCGTTCTGGCCGGAGGTT
ATGAACGCCAAATCCTGGGCCAAGGACGTCAAAGCCTTCTGCCCCGGCGTAGGCAAAG
GCCCTGTGATCCCGGCTGAGCGTATCGAGCAACAGATTCGCGAACAAATCAAAAGCGA
ACAGGGCTGGGGCAAGTAAgctgcttcagtttccgcccctgccggggctgcagctctaccggctgccgccgaggctgtccaagctt
tagacagtcaggcatttcttaccgttatccagcaaattccATG

    Bd0553 Gene: Bd0553     GI: 42522152     BI number: Bd0553     GOG: -------     Description: gc t  c cg cg cg cg gc c  t c  | t  | t  | t  | g  | a  | c  | t  | t  | cg gc                   c ta        gc       g  t cg       t  c      a  t gc        cg       a  t At        gc       c  a |  c       gc        cg At        cg        ta Ta       c  |       gc Gc       a  |       ta A  c       ta        cg A  g       cg        gt Cg       t  |       gc Gc        cg       a  a Gt        gc       g  | |  g       at        cg Gc        cg        cg Gc        gt        gc                         atttcttaccgttatccagcaaattccATG     ..................................................................................................................