                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-14.80 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGCATCAGCAAGGGTTTGCACCCACTCTACTTTATAGTTTTCGAGTTCCAACTGCA
GTTGGACGGCTTTGCCAATTACTGGGTCATCTTCAAGCAGAAAAATAGTGCTCATatag
tctccagcctaccataggcttcgtggttgtctcaggtcttattcttaccggggagtattgagcaattgtggaagctgggccaatgtcccggtttgaaacg
gggacccggggtgttgaagctggtcaaagcccttgggatcaggcatgatttcccagagtttttagcaaatgtaaggagacctcATG

    Bd0570 --- Bd0571 --- Bd0572 --- Bd0573 Gene: Bd0570     GI: 42522166     BI number: Bd0570     GOG: COG0537     Description: HIT family hydrolases Gene: Bd0571     GI: 42522167     BI number: Bd0571     GOG: COG0221     Description: - Gene: Bd0572     GI: 42522168     BI number: Bd0572     GOG: COG4728     Description: - Gene: Bd0573     GI: 42522169     BI number: Bd0573     GOG: COG2070     Description: 2-nitropropane dioxygenas ac a  g a  g g  g tg ta t  c       ct gc       g  g gc       a  g cg        at cg        gc cg        ta t  g       ta g  t      g  a       gc tg        tg       g  a at        gc        at at        gc        cg cg        gc        ta c  a      |  t      |  t g  |       gt       |  t g  |       cg        at g  |       cg        gc ta        cg        gc cg       |  a       gc gc        at        ta at        gc        tg                         agtttttagcaaatgtaaggagacctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [FGR] COG0537 Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases ... can be seen here [C] COG0221 Inorganic pyrophosphatase ... can be seen here [S] COG4728 Uncharacterized protein conserved in bacteria ... can be seen here [R] COG2070 Dioxygenases related to 2-nitropropane dioxygenase ... can be seen here     ..................................................................................................................