Gene putatively regulated by attenuation in B_bacteriovorus
Characteristics of the secondary structures
Terminator: Distance from promoter:63 nt. Distance to gene:38 nt. Distance to run of Ts=2 nt. Size=28 nt. Delta G=-10.40 kcal/mol
Antiterminator: Distance from promoter:38 nt. Size=37 nt. Delta G=-14.30 kcal/mol
Anti-antiterminator: Distance from promoter:2 nt. Size=44 nt. Delta G= -8.02 kcal/mol
Nomenclature/Definitions
The most likely promoter is: tcgata-taaagt. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
tcgatagacctcgatcgccagtataaagtggagcagttcttgctttgctgtaattcctgaaagtttaggcctgttgagttggatatggtgtccggctcag
acccaattttgggttcgctgtctcttttttagacggcggcaagtggtttaaatcgatttgggagtacgtATG
Bd0607
Gene: Bd0607 GI: 42522200 BI number: Bd0607 GOG: ------- Description: conserved hypothetical protei
a
a t
t t
g c g
t c t g
c t a t
g g tg
ta at
ta gc tt
ta gc a t
cg tg at
gt tg cg
| t gc cg
t t at cg
ta gc at
cg ta gt
t g tg a c
t c g a c |
gc t c t |
at c | cg
cg c | gc
gt gc gt
at gc cg
tctcttttttagacggcggcaagtggtttaaatcgatttgggagtacgtATG
..................................................................................................................