                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-21.50 kcal/mol
Antiterminator: Size=58 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCAGGCGGCGACCAACGTGATGGACGAACACATCATCGAAGCCAAATGGGGTGCCTT
CGGCGAAGTCATCTGGACATACCAGAACCAGCCGGCAAAGCTGGAATACATGGTTCGC
CATTATCTGACTCTCTTCATCAAAGAGAGCTCCAAATAAgaaaggccccggaaggggcctttttcattttt
gcagagccatccaatcaaaggaagagcgaacgcaattatctcctgagccgcgactaataaaaatgtaatcaaggtcctagttcctttgtcgtcccggcaa
gggtaggactgttGTG

    Bd0630 Gene: Bd0630     GI: 42522220     BI number: Bd0630     GOG: -------     Description: putative transporte             T           A  C           C  A            TA            TA            CG            TA            CG            TA            CG           |  C            AT            GC           |  C   A       T  A A  A      C  A CG        TA GC        AT GT        TA CG        TA CG       |  g       ga |  A      |  a      g  a |  A      |  a       cg |  T      A  a       cg |  A       Cg        cg |  C       Cg        cg G  A       Gc        gc AT       C  c       gc CG       T  |       at CG       T  |       at AT        Gc        at AT        Gc        gt GC        Tg        At                         catttttgcagagccatccaatcaaaggaagagcgaacgcaattatctcctgagccgcgactaataaaaatgtaatcaaggtcctagttcctttgtcgtcccggcaagggtaggactgttGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-16.20 kcal/mol Antiterminator: Size=58 nt.     Delta G=-13.00 kcal/mol Anti-antiterminator:   Size=24 nt.     Delta G= -7.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTCAGGCGGCGACCAACGTGATGGACGAACACATCATCGAAGCCAAATGGGGTGCCTT CGGCGAAGTCATCTGGACATACCAGAACCAGCCGGCAAAGCTGGAATACATGGTTCGC CATTATCTGACTCTCTTCATCAAAGAGAGCTCCAAATAAgaaaggccccggaaggggcctttttcattttt gcagagccatccaatcaaaggaagagcgaacgcaattatctcctgagccgcgactaataaaaatgtaatcaaggtcctagttcctttgtcgtcccggcaa gggtaggactgttGTG     Bd0630 Gene: Bd0630     GI: 42522220     BI number: Bd0630     GOG: -------     Description: putative transporte             T           C  C           G  C            AA            GA            AA            GT            AA            AA            Ag           |  a            Ca            Ta           |  g           A  g           C  c            Tc            Tc            Cc            Tg   T       |  g A  C      |  a C  A      |  a TA       C TA        T CG        C        ga TA        A       g  a CG       G         cg TA       T  |       cg CG       C  |       cg |  C       T        cg AT        A        gc GC        T        gc                         tttttcatttttgcagagccatccaatcaaaggaagagcgaacgcaattatctcctgagccgcgactaataaaaatgtaatcaaggtcctagttcctttgtcgtcccggcaagggtaggactgttGTG     ..................................................................................................................