                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGGAATCTGTCACCGCTGCTGGTTCACGAACCGGCGGGGTCGTCGTTGGCGGAGTC
GTGCTCGGTGGAGTTGTTGTCGGAGGCGTCGTTGCTGGAGGAGTTGTGCCTGCGTTGC
TGCCACCGCCGGAGTTCACCGGCTTCTTCGCCATGGCGAAGGTCGTGGAGGAAACAGT
TGTAGTTACTAGAAGAGCCATCAGGATGTTGGTTGTGCTTTTTTGTGTTTTCATacctcc
tagatcggagataggtcgcgcgactaaaggcgttctggaccatttttaggtccagttttcaggatcTTG

    Bd0644 --- Bd0643 --- yugS Gene: Bd0644     GI: 42522233     BI number: Bd0644     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd0643     GI: 42522232     BI number: Bd0643     GOG: COG2933     Description: methyltransferase Gene: yugS     GI: 42522231     BI number: Bd0642     GOG: -------     Description: Hemolysi AT G  G       ga GT       a  t AT       t  c CG        cg TG        cg |  T       ta        ta AT        cg       c  a CG       c  a      a  a |  T       at       g  g CG        Ta        cg GC       A  |       gc AT        Cg        cg GT        Tg        gt AT       T  t      |  t AT       T  c      |  c GT        Tg       |  t AT        Gc       |  g T  |       Tg        cg CG        Gc        ta AT        Tg        gc TG        Ta        gc                         atttttaggtccagttttcaggatcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2933 Predicted SAM-dependent methyltransferase ... can be seen here     ..................................................................................................................