                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCGCTGGCACCAAATCCCCGTCTTCTTTTGAAACTTCCCGTGCGTGTCTGGAAAGA
TCTCTGAGCCACAAAGACTTCATCAAAGTGATCGTCTACACTTTGGAGTAGaggctcaacac
gattctcatttcgtttgcaggaagaagtgattcaacacttcttcctttttttttgctcttgttcaactcgactgagtgcgatctcaccggaaaaggcgag
agaccttttgctttttttgcgtccttttgcttgcctcatcttagccccctaattaaaatgataaggaagctttagtatgcTTG

    Bd0646 Gene: Bd0646     GI: 42522235     BI number: Bd0646     GOG: -------     Description: transcriptional regulator, MarR famil            tc   c       t  a g  a      a  a t  g       gc t  g       ta t  a       gc g  a       at cg        at ta        gc ta        at tg        at at        gc cg        gc ta        at             ttttttttgctcttgttcaactcgactgagtgcgatctcaccggaaaaggcgagagaccttttgctttttttgcgtccttttgcttgcctcatcttagccccctaattaaaatgataaggaagctttagtatgcTTG     ..................................................................................................................