Gene putatively regulated by attenuation in B_bacteriovorus
Characteristics of the secondary structures
Terminator: Distance to gene:77 nt. Distance to run of Ts=0 nt. Size=27 nt. Delta G=-10.30 kcal/mol
Antiterminator: Size=39 nt. Delta G= -5.30 kcal/mol
Anti-antiterminator: Size=45 nt. Delta G=-18.00 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CGTTAAAAAAACGACCAAAAAAGTTTCCAAGAAGAAGTAAttcctctcgaaaaaacttaagtcacaaaaa
aggaaggccccaagccttcctttttttattcccaacccccaaaaggtacctgcttacttttgcagaagcggcgctcccaacgcgatgtttatgcaaaagt
aagcaggtaccttttttttcccggtccttgatcttgtggcttggggaccttttgtcttgttccgcgataaactgtggacactttgtgtttgccgctgaca
gcatgaatagacatccatggagggactactATG
Bd0696
Gene: Bd0696 GI: 42522282 BI number: Bd0696 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critic
c
c a
c a t
t c t t
cg t t
gc t c
cg t c
g a t c
gt cg
cg cg tg
gt at t t
at t c cg
at gc tg
g a gt | c
at at at
cg cg gt
gc g a tg
ta a t tg
ta a | cg
ta t | cg
ta gc ta
cg at gc
at at gc
ttttgtcttgttccgcgataaactgtggacactttgtgtttgccgctgacagcatgaatagacatccatggagggactactATG
..................................................................................................................