Gene putatively regulated by attenuation in B_bacteriovorus
Characteristics of the secondary structures
Terminator: Distance to gene:76 nt. Distance to run of Ts=2 nt. Size=26 nt. Delta G=-12.90 kcal/mol
Antiterminator: Size=39 nt. Delta G= -8.81 kcal/mol
Anti-antiterminator: Size=51 nt. Delta G=-11.30 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TCAGAATAATTAACGGGCGCAAGAGTGCTGCCGGCGTTTGCTTCCATcttcgggctccttggctt
tttacagccgtgcttgttacagctgggaccttaccttcactaaggctgatcccgttggttaaaggattatgtgtgcggggtttgtagcacaagcaccccc
cttttcctagggatttcatataattgggggcccattcgggggtcttcagagtctttttcaggaattcttacactctctgcccagtcagtgaccaccctcg
tctgtgtttaaaccgggttttccagacacagggccTTG
Bd0731 --- Bd0730
Gene: Bd0731 GI: 42522316 BI number: Bd0731 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critica
Gene: Bd0730 GI: 42522315 BI number: Bd0730 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critic
g
a c
t a
gc
ta
ta c
tg t c
gc t t
| a ta
gc tg
gc cg
gc cg
c c | a
g | | t
t | | t
g | | t
t | | c
g | | a
t | | t
a | | a tc
t | | t t g
t | | a a g
a | | a cg
gc | t cg
gc | t cg
at cg gt
at cg gc
at cg gt
t t cg gt
t | a | gc
gc cg ta
gc gc tg
agtctttttcaggaattcttacactctctgcccagtcagtgaccaccctcgtctgtgtttaaaccgggttttccagacacagggccTTG
..................................................................................................................