Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=69 nt.     Delta G= -9.52 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCCTGCATCATGGGATCCATGATGGCCTCCCACACAATCCAGGATTTCTCTGTGAAA
GCTCTGGCGAAAGTGACTTTGGGCGATCTTGAAAAACGCCTGACTGAGTACAAGAAAG
TCATCACTGTTTAAattcctgtcaaaggcctccactctggaggcttttttctttgttaagatgtcttgtgatttgaagataaattgaaaa
atgtttgttattgaaagtccggtttttagacaagaagcaaacaattgttgtttagtcctcttttgggaagatctgcgattccgatgcgtagagtATG

    Bd0735


Gene: Bd0735     GI: 42522319     BI number: Bd0735     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


            C
          A  A
          T  A
          G  G
          A  A
          G  A
           TA
           CG
           AT
           GC
           TA
          C  T
          C  C
          G  A
          C  C
          A  T
          A  G
  G       A  |
T  A       AT
T  A       AT
C  A       GT
T  A       TA
A  A       TA
 GC       C  a        t
 CG       T  t      c  c
 GC        At       a  t
 GC        Gc        cg
 GT       |  c       cg
|  G      C  t       ta
|  A      G  g       cg
|  C       Gt        cg
T  T       Gc        gc
 TG        Ta        gt
 TA        Ta        at
 CG        Ta        at
 AT        Cg        at
                        ttctttgttaagatgtcttgtgatttgaagataaattgaaaaatgtttgttattgaaagtccggtttttagacaagaagcaaacaattgttgtttagtcctcttttgggaagatctgcgattccgatgcgtagagtATG


    ..................................................................................................................