Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -9.42 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCTTGAAAAAGATCTTAACTCTGAAGTGGTTAAGAAACGTATCGAAGCGGACATGG
AAGAAGCTCGTAAATTCAACTTCTCCGGTACTCCAGGCTTCCTGATCAACGGTGTTTC
CCTGCGTGGCGCTTATCCATTCGCTGATTTCAAAGAAATCATCGACCGTCACTTGGCT
GAAGCGAAGTAAtctttcctgaagattgaacttcaaaaacccacagtttgaaaaaactgtgggttttttatttgcgcggtacaggtccagc
cactaaagtaatcgtaaatacaccaaggagttcccATG

    Bd0786


Gene: Bd0786     GI: 42522365     BI number: Bd0786     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


            c
          c  t
           tg
           ta
           ta
           cg
           ta
           At
           At
          |  g
          |  a
           Ta
           Gc
           At
           At
           Gc
          C  a
          G  a
          A  a
          A  a
          G  a
          T  c
          C  |
           Gc        aa
           Gc       g  a
           Ta        ta
          |  c       ta
           Ta        ta
           Cg        gc
           At        at
 GA       C  |       cg
T  A      T  |       at
 CG       G  |       cg
 GC       C  |       cg
G  G      C  |       cg
 TA        At        at
 TA        Gt        at
 CG        Cg        at
 AT        Ta        at
                        ttatttgcgcggtacaggtccagccactaaagtaatcgtaaatacaccaaggagttcccATG


    ..................................................................................................................