Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=2 nt.   Size=17 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=27 nt.     Delta G=-12.90 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAAAGACGACTTTCCGGCATTGGAGCGGCCAGCGATGGCTACTTCAGCTTTCTTGT
GTACAGGGAAGTCTTTTTCCAGAACGGCGCTTTTAATGAACTGAATCGTCTTTGGCAT
AGCCAAGACTATCAGAGCTCCCCCCATttctcaattccgagaacctagtccgtcgcaggataatttggcgagtcgaaaag
cccgagccccacttatattcgaatccagcccggtcaaagtcttgaagtggtgggtcatcgcattccccaccacaaaggtgggcactttttaagcaggaga
ccccATG

    Bd0805


Gene: Bd0805     GI: 42522381     BI number: Bd0805     GOG: -------     Description: nitrogen assimilation regulatory protei


  c
g  c
a  c
 cg
 cg
|  t
t  c
a  a
a  a
g  a
c  g
t  t
t  c
a  t
t  t        g
a  g      c  c
 ta       t  a
 ta       a  t
 cg       c  t
 at       t  c        a
 cg        gc       c  a
 cg        gc       a  a
|  t       gc        cg
 cg        ta        cg
 cg        gc        at
g  g       gc        cg
 at        ta        cg
 gc        gc        cg
                        cactttttaagcaggagaccccATG
    ..................................................................................................................