Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCGGGAAACCGTCGCAAGAGGTGTCTAATGGGTCGTAAAGATAGCCGCTTTTATCC
AGCACCATGCGCGCAGCCGCTGTTTTGCGGTCCGCAGTTTTTTGCAGAGACGTACACT
GAACCAAGGAAAAAGCCAGAACCAGCCAGAATAAAACGCGCATgatatccccatgaagaagtccttat
tcaattatgggggcttttatgcccttatcaaatgcaaattttccataatcattcctttgttggggttggttttcccgatatgccggggtccggtgtcatc
atcatagggaggcctcATG

    Bd0815


Gene: Bd0815     GI: 42522391     BI number: Bd0815     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


            C
          C  A
          A  T
           CG
           GC
          A  G
          C  C
  G       C  G       TT
A  C      T  C      G  T
T  C      A  |      T  T
A  G      T  |       CG
 GC       T  |       GC
 AT       T  |       CG
 AT        TA        CG
 AT        CG        GT
T  T       GC       A  C
G  |      C  C      C  |
C  |       CG       G  |
 TA        GC       C  |
 GT        AT        GC
 GC        TG        CG
 GC        AT        GC
 TA        GT        TA
                        GTTTTTTGCAGAGACGTACACTGAACCAAGGAAAAAGCCAGAACCAGCCAGAATAAAACGCGCATgatatccccatgaagaagtccttattcaattatgggggcttttatgcccttatcaaatgcaaattttccataatcattcctttgttggggttggttttcccgatatgccggggtccggtgtcatcatcatagggaggcctcATG


    ..................................................................................................................