                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.90 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -7.43 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGACGTGGTCGAAACCACACGTGGAGAGGCGGAGGAAGACCCCAACGCCTGGAGCA
AAGTCACAATTCAGGCCGACAAAGGCGTGGATTTCCTGACGGTCAAAAAGGTTCTGTT
CACTGTGACAGAGGCCGGGGCTGGCGAAATCAACTTTGCGGTGACCAAGCTTCCTCAG
GAAACGAATTCGAATTAAgaataaaaatacatgaaagcccggtgaaaaccgggctttttgtttttcatcccggtacagcatccgacg
cggaagttttgaccgcgggtctgtgatggtttaagattcTTG

    Bd0840 --- nrtD --- rpoN Gene: Bd0840     GI: 42522413     BI number: Bd0840     GOG: -------     Description: conserved hypothetical protein Gene: nrtD     GI: 42522414     BI number: Bd0842     GOG: COG1137     Description: ABC-type nitrate transporter, ATPase component Gene: rpoN     GI: 42522415     BI number: Bd0843     GOG: COG1508     Description: RNA polymerase sigma-54 facto             T           A  T           A  A           G  A            Cg            Ta            Ta TG        At T  C      |  a TG       A  a CG       G  a A  |      C  a AT       A  a CG       A  t TA       A  a A  C      G  c A  C      G  a A  A       At G  A       Cg        aa CG        Ta       g  a GC       C  |       ta GT       C  |       gc T  T       Ta        gc C  |       Ta        cg GC        Cg        cg GC        Gc        cg GT       A  c       gc GC       A  c       at |  A       Cg        at CG        Cg        at CG        At        gt                         tgtttttcatcccggtacagcatccgacgcggaagttttgaccgcgggtctgtgatggtttaagattcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1137 ABC-type (unclassified) transport system, ATPase component ... can be seen here [K] COG1508 DNA-directed RNA polymerase specialized sigma subunit, sigma54 homolog ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-11.80 kcal/mol Antiterminator: Size=58 nt.     Delta G= -7.43 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGCGACGTGGTCGAAACCACACGTGGAGAGGCGGAGGAAGACCCCAACGCCTGGAGCA AAGTCACAATTCAGGCCGACAAAGGCGTGGATTTCCTGACGGTCAAAAAGGTTCTGTT CACTGTGACAGAGGCCGGGGCTGGCGAAATCAACTTTGCGGTGACCAAGCTTCCTCAG GAAACGAATTCGAATTAAgaataaaaatacatgaaagcccggtgaaaaccgggctttttgtttttcatcccggtacagcatccgacg cggaagttttgaccgcgggtctgtgatggtttaagattcTTG     Bd0840 --- nrtD --- rpoN Gene: Bd0840     GI: 42522413     BI number: Bd0840     GOG: -------     Description: conserved hypothetical protein Gene: nrtD     GI: 42522414     BI number: Bd0842     GOG: COG1137     Description: ABC-type nitrate transporter, ATPase component Gene: rpoN     GI: 42522415     BI number: Bd0843     GOG: COG1508     Description: RNA polymerase sigma-54 facto   a a  t a  a a  c aa tt ag aa |  a g  a A  g A  c T  c T  c A  g A  g G  t Cg Ta Ta A  | A  | Ga C        aa A       g  a A        ta A         gc G         gc G        cg A        cg C        cg             ctttttgtttttcatcccggtacagcatccgacgcggaagttttgaccgcgggtctgtgatggtttaagattcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1137 ABC-type (unclassified) transport system, ATPase component ... can be seen here [K] COG1508 DNA-directed RNA polymerase specialized sigma subunit, sigma54 homolog ... can be seen here     ..................................................................................................................