                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-13.91 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCATAGGCTTCCAACTCGGAAAGAGCAGGGCTGATCAGGGCTTTAGAGACGCCCAG
TCTTTGAGTCAATTCGGCGCCGCTAAGGCTGGTCTTTGACAAAAAGACCTGAGTCCAA
ATTTGGCCGTGAATTCTGCGAAACCCCCAGTAACGAATAAAGTCCCCCACGGACTCTG
ACAGGTCACGGAGTTTATTGATTTCAGCTGTGGCGGTTGACGCGGTTGTTTTTTGGTC
TGCTTTTCTCATttagttcatgctaccatgaactaaagtcaccatcaaggtgcggaggagaatttgtcATG

    Bd0909 --- catD --- yeeZ --- Bd0912 Gene: Bd0909     GI: 42522479     BI number: Bd0909     GOG: -------     Description: putative redox protein Gene: catD     GI: 42522480     BI number: Bd0910     GOG: -------     Description: putative hydrolase Gene: yeeZ     GI: 42522481     BI number: Bd0911     GOG: -------     Description: putative enzyme of sugar metabolism Gene: Bd0912     GI: 42522482     BI number: Bd0912     GOG: -------     Description: conserved hypothetical protei            GG           A  T           C  C   C       A  A C  C       GC C  A       TG CG        CG AT        TA A  A       CG A  A       AT GC       |  T CG       |  T |  A      |  A |  A      |  T |  T      |  T |  A      |  G G  A      |  A TA       |  T CG       |  T |  T      |  T T  C      |  C       GT T  C      |  A      G  T A  C      |  G      C  G A  C       GC       G  A GC        GT        GC TA        CG        TG GC        AT        GC CG        CG        TG CG        CG        CG |  A      |  C       GT GC        CG        AT GT        CG        CG                         TTTTTTGGTCTGCTTTTCTCATttagttcatgctaccatgaactaaagtcaccatcaaggtgcggaggagaatttgtcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.40 kcal/mol Antiterminator: Size=50 nt.     Delta G=-13.91 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G= -6.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGCCATAGGCTTCCAACTCGGAAAGAGCAGGGCTGATCAGGGCTTTAGAGACGCCCAG TCTTTGAGTCAATTCGGCGCCGCTAAGGCTGGTCTTTGACAAAAAGACCTGAGTCCAA ATTTGGCCGTGAATTCTGCGAAACCCCCAGTAACGAATAAAGTCCCCCACGGACTCTG ACAGGTCACGGAGTTTATTGATTTCAGCTGTGGCGGTTGACGCGGTTGTTTTTTGGTC TGCTTTTCTCATttagttcatgctaccatgaactaaagtcaccatcaaggtgcggaggagaatttgtcATG     Bd0909 --- catD --- yeeZ --- Bd0912 Gene: Bd0909     GI: 42522479     BI number: Bd0909     GOG: -------     Description: putative redox protein Gene: catD     GI: 42522480     BI number: Bd0910     GOG: -------     Description: putative hydrolase Gene: yeeZ     GI: 42522481     BI number: Bd0911     GOG: -------     Description: putative enzyme of sugar metabolism Gene: Bd0912     GI: 42522482     BI number: Bd0912     GOG: -------     Description: conserved hypothetical protei            GG           A  T           C  C   C       A  A C  C       GC A  C       TG AC        CG AA        TA G  G       CG C  T       AT GA       |  T TA       |  T |  C      |  A |  G      |  T |  A      |  T |  A      |  G C  T      |  A TA       |  T TA       |  T |  A      |  T A  G      |  C       GT A  T      |  A      G  T G  C      |  G      C  G T  C       GC       G  A GC        GT        GC CC        CG        TG CC        AT        GC GA        CG        TG GC        CG        CG |  G      |  C       GT TG        CG        AT TA        CG        CG                         TTTTTTGGTCTGCTTTTCTCATttagttcatgctaccatgaactaaagtcaccatcaaggtgcggaggagaatttgtcATG     ..................................................................................................................