                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCAAAACCATCATAATGACAGGCAGCGCCACAAATAGAACCCCCGCCAAGGTGGCCG
CGATCTGGCGATCCGGGATGCCCCGGAACAAGGCCATCACAGCCAGGATCACAATCAC
TTCCGCTATTAAATATCCGAGAAAAGCATTTCGTCTCATATCCAAgacgctagtccacccccgcaga
caactcaagggggaagcttgcccagcacccttttattttgatttgaaggccgaactgtccggcaaccaccttgcaattggggttatccgaacaacgaaac
cttttaagggggcttcaATG

    Bd0938 Gene: Bd0938     GI: 42522505     BI number: Bd0938     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic aa c  c at gc a  a c  a g  |        c cg       g  c cg       t  c cg        ta cg        cg cg        gc a  a      a  a c  a      a  | c  |      g  | tg        gc gc        gc at        gc t  t       gt cg        at gc        at             tattttgatttgaaggccgaactgtccggcaaccaccttgcaattggggttatccgaacaacgaaaccttttaagggggcttcaATG     ..................................................................................................................