                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.24 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAGCATGGAACATAAAAAAGAGATACCGATGGTACTGATAAACAGAACAATAATAAT
CGTCATagagtgatgcttaaatctgagaagttaaatgtgacgggcagacgcctgtgatattccatagagactagagtgtaccacattcgggaaggg
acctgtctataacgcgacttgcaagaagtcctgatataatcgagataaatcaggaatttgtgagtcatcaggaccctgatgagggttttttgacctttcg
ccgggcccttcatagactttggtaaagcttaaaaggagtactaaagATG

    Bd0982 Gene: Bd0982     GI: 42522544     BI number: Bd0982     GOG: COG0412     Description: dienelactone hydrolase family protei   a c  a g  g ta ta cg at         g gc       a  g c  c      c  a gt        ta cg        at a  a       at at        at ta        tg at        at ta       g  | |  a      a  | |  t      g  | |  c       cg |  g       ta |  a      a  g |  g      a  t |  a      t  c |  t      a  |       ac |  a       ta       g  c |  a       at        gc c  a       gc        at t  t       ta        cg gc        cg        ta ta        cg        at cg        ta        cg cg        gc        ta                         gggttttttgacctttcgccgggcccttcatagactttggtaaagcttaaaaggagtactaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG0412 Dienelactone hydrolase and related enzymes ... can be seen here     ..................................................................................................................