                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-23.20 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTCTCCATGGAATTCGCGAAGTACGCTCCAGTACCTCGTAACATCCAGGAAGAACT
TGCGAAGAAATACCAAGCTAAGCGCGCAGCTGAGCAGAAGTAAtttcgcgcggatgcgcaggaggtgc
gaagcactggactgcgtcccgctaagtttgatcttcaaacttcaaagcccggtggaaacaccgggctttttttatttccctgcctcgacttatatccaga
aaaactaaacatcgcagtctgttgtgccgaaaagagattcgtaaattcatctttcagccccgaggacgacagccATG

    Bd0986 --- Bd0984 Gene: Bd0986     GI: 42522547     BI number: Bd0986     GOG: -------     Description: - Gene: Bd0984     GI: 42522546     BI number: Bd0984     GOG: -------     Description: conserved hypothetical protei   a g  a cg gc ta gc gt         c |  g      t  t a  g      a  t g  a       gc gc        ta at        ta cg        ta gc        gc cg        at gt        at t  |      |  c       aa a  |      |  a      g  a gc       |  a       gc gc       |  a       ta c  |      |  g       gc gc       |  c       gc cg       |  c       cg gc       |  c       cg c  t       tg        cg ta        cg        gc ta        gt        at tg        cg        at At        cg        at                         ttttatttccctgcctcgacttatatccagaaaaactaaacatcgcagtctgttgtgccgaaaagagattcgtaaattcatctttcagccccgaggacgacagccATG     ..................................................................................................................