                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-18.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCAGATGCTGGGAGATCTTAATTATTGAAATCAGACGTAAAACCGAGCGGTCATAGC
GGCGCTGATTGCCGTTGTTGCGATGACTTTTAATCAGTCCTTTGGATTCATAGAAATG
CAACGTCGGAACCGAGATGCCGCTGCGGGCGGCGACTTCGCCAACCGACAGTGTGGTG
GTGAGGGCAGGGGTTGTGGTTTTTGCAGCCATatttgttttgacctcaagttaacttgaggttgtagcatcagcta
aaaatcacgcaagcaatttaatcgcttggcttgtgcctaaaggagaattcGTG

    Bd1003 Gene: Bd1003     GI: 42522564     BI number: Bd1003     GOG: -------     Description: conserved hypothetical protei            TG           G  T           A  G            CG            AT           G  |       GT            CG       T  G CT        CG       T  G A  T       AT        GT GC       |  G       GT CG       |  A       GT GC       A  G       GT GC        CG        AT C  A       CG        CG G  A       GC        GC GC       |  A      G  A GC        CG       G  | CG        TG       A  | |  A       TG       G  | GC        CG        TG TA        AT        GC CG        GT        GC GT        CG        TA CG        GT        GT                         atttgttttgacctcaagttaacttgaggttgtagcatcagctaaaaatcacgcaagcaatttaatcgcttggcttgtgcctaaaggagaattcGTG     ..................................................................................................................