                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGAAATAATCTCAGCGTGAGCTGAGGCCTGAATCAAAGTCACAGCGGCAAGCAAACC
CGCCACCCATTGTGTGTTCTTCATaaagacgctcctgttttaatagacagtgcggatcagtccaaagttcgtgcctccacaa
tggttcctaaataagctctaattttgagctgggcattttttactgactcagaattagacagcaggtcctttttcggcggcgctcccaagtcctcatggga
actgtgtttttgcagctttcagaaagaaaacgggtgaccccgcaaagggtgcgatagcaaTTG

    Bd1043 Gene: Bd1043     GI: 42522600     BI number: Bd1043     GOG: -------     Description: Trypsi tt t  t a  t c  t g  a gc         c gt       g  a t  g      a  g c  a       cg gc        at        cc at        gc       t  t gc       a  c      g  c ta       t  t      a  a tg       t  |       at ta        at        cg ta        at        cg at        gt        cg at        at        ta ta       c  c      c  a cg        tg       g  | ta        cg       c  | |  c      a  |       gc |  a       gc        gt cg        tg        cg gc        cg        gt                         gtttttgcagctttcagaaagaaaacgggtgaccccgcaaagggtgcgatagcaaTTG     ..................................................................................................................