Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-13.84 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAAAGCAGCAACCAAGGTTTTTAAGGCCGGGGAGGGGCTATTAAATGCGTTCATGGG
GTGACTCCTTGATGTGATCATCAAttgctatcgcaccctttgcggggtcacccgttttctttctgaaagctgcaaaaacaca
gttcccatgaggacttgggagcgccgccgaaaaaggacctgctgtctaattctgagtcagtaaaaaatgcccagctcaaaattagagcttatttaggaac
cattgtggaggcacgaactttggactgatccgcactgtctattaaaacaggagcgtctttATG

    Bd1044


Gene: Bd1044     GI: 42522601     BI number: Bd1044     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


 GA
T  T
 GC
 TA
 AT
 GC
 TA
 TA
|  t
|  t
|  g
|  c
C  t
C  a
T  t
C  c
A  g
 Gc
 Ta
 Gc
 Gc
 Gc
 Gt
T  t
A  |       tg        tc
C  |      t  c      g  a
T  |       tg        gc
T  |       cg        gc
 Gt        cg        gc
 Cg        cg        cg
 Gc        at        gt
                        tttctttctgaaagctgcaaaaacacagttcccatgaggacttgggagcgccgccgaaaaaggacctgctgtctaattctgagtcagtaaaaaatgcccagctcaaaattagagcttatttaggaaccattgtggaggcacgaactttggactgatccgcactgtctattaaaacaggagcgtctttATG
    ..................................................................................................................