                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCAAGCGGCCATCATGAAGAATGTGGTCGATGAACTGAACAATGTTGTGTATGGCGA
CAGAGGTGTACAGGTTTCCGCTCAAACACCAGCAGCAAGGACAACTGCTCATTCAGAA
ATGGACGAAGAAGGCTGGAAAGCCGCTTAGttcgaattgaagttctccacccggggaatggattcctatggctcgcag
aatcaagcatgaccccggtcatgcttgttttttttgaagcggggataaagtgcaatcacccaagcacgggtccctgccgatgaccggcagagttcaagga
gtcactATG

    Bd1082 --- Bd1084 --- Bd1085 Gene: Bd1082     GI: 42522636     BI number: Bd1082     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd1084     GI: 42522637     BI number: Bd1084     GOG: -------     Description: putative metalloprotease Gene: Bd1085     GI: 42522638     BI number: Bd1085     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic            gc           g  t           t  c           a  g           t  c           c  a            cg cc        ta a  c       ta        cc cg        at       c  g cg        gc        cg tg       |  a       at cg       |  a       gc ta       |  g       ta ta        gc        at gt        ta        cg a  g       at        gc a  |      |  g       at g  |      a  a       at tg        gc        cg ta        gc       t  | at        gc        at at        gc        at gc        cg        gt                         tttttgaagcggggataaagtgcaatcacccaagcacgggtccctgccgatgaccggcagagttcaaggagtcactATG     ..................................................................................................................