                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggcttttttgttttctgattactgatgccgcgctttcttggcgctgcggaactcggttggaggctgcaaaacccccaaccattccccctcataccgcctt
atctaaaaggtacctgcttacttttgcagaagccctgcgttggcggaaaaggtacctgcttactttttccgaagcggtgcgtttattttgtaggggtaca
ggacggcttgcatgttgagggtggggtggctgaactccaaattttttgttactgattttttcaaataagcggtagcctttttccaacaggagaaatcatc
ATG

    Bd1106 Gene: Bd1106     GI: 42522655     BI number: Bd1106     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic            tg           a  t gg       c  t g  g      g  g at        ta ta        tg gc        cg        ct ta       g  g      g  g tg        gt       g  a tg        cg        ta ta       a  g       gc |  c      g  g       gt a  g      g  |       gc t  g      a  |       gc t  c       cg        ta t  t       at       g  a gt        tg       g  a cg       g  g       gt gc        gc        at ta        gt        gt                         tttgttactgattttttcaaataagcggtagcctttttccaacaggagaaatcatcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.30 kcal/mol Antiterminator: Size=38 nt.     Delta G= -5.20 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -4.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ggcttttttgttttctgattactgatgccgcgctttcttggcgctgcggaactcggttggaggctgcaaaacccccaaccattccccctcataccgcctt atctaaaaggtacctgcttacttttgcagaagccctgcgttggcggaaaaggtacctgcttactttttccgaagcggtgcgtttattttgtaggggtaca ggacggcttgcatgttgagggtggggtggctgaactccaaattttttgttactgattttttcaaataagcggtagcctttttccaacaggagaaatcatc ATG     Bd1106 Gene: Bd1106     GI: 42522655     BI number: Bd1106     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic            gg           a  a           c  c           a  g            tg            gc            gt        ct           g  t      g  g   t        gg       g  a t  t       ac        ta tg       t  a       gc at       g  t       gt ta       t  |       gc tg       t  |       gc tg        tg        ta g  g       tt       g  a cg        at       g  a gt       t  g       gt ta        ta        at gc        tg        gt                         tttgttactgattttttcaaataagcggtagcctttttccaacaggagaaatcatcATG     ..................................................................................................................