                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-12.16 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCTGCACGCCGTAAGAGGACGGCGCCAAAGTCAGGGAATTTCGCAGGGTTGTCCAG
TCGGCATCCGAGATCTTTTTGGTCGCATCGTACTTTTTAGTGGCGTAGCGCCACTCCA
GGGCATCTTGAATCGTTTTATGGGTCATGGGAAGGGCTCCTTTAATTGTGTCAAATAC
AGGCACagtatgccgtggttggaatttaaatgcaacagtaaaagatacatttaaggaagcctcgggtccttagggacttaattccttgatattgtt
tatttttgaggcttaaggtaagatctagacATG

    Bd1163 --- Bd1164 Gene: Bd1163     GI: 42522704     BI number: Bd1163     GOG: COG1959     Description: transcriptional regulator Gene: Bd1164     GI: 42522705     BI number: Bd1164     GOG: -------     Description: putative ribosomal protein N-acetyltransferas   a t  a g  a a  a c  g a  a a  t c  a gc                  ta ta                 t  g at                  cg at                  cg at                  ta ta                  gc ta                  gt tg         c        gt a  g      t  g      c  a a  a       cg       t  a g  |       cg       c  | g  |       gt       c  | ta       a  |      g  | tg       a  |       at gc        gc        at gc        gc        gc t  t       at        gc gc        at        at cg        ta        at cg        tg        tg                         atattgtttatttttgaggcttaaggtaagatctagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1959 Predicted transcriptional regulator ... can be seen here     ..................................................................................................................