Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-23.40 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTGGTGAAGCTGAAGATCACAGCTGGAAATCCCACTCCACAACCTCTTCCGGGTTG
GGGGCGATGGCAGAGGCTTTGAAGGGCCTTAACATCAAGAAGAACTAGttgtttcattttgata
ttctgaagttgtcaaaagccctttgggtctaaacccaaggggcttttttttgtggctactttagtttggaaaacagtttttcatcatttttccggttaat
cctcaataaaactgttccacgagccgataagtgtgtcagaagcgaacccatttgaacgtctatcggggtcaaggaatcATG

    Bd1199


Gene: Bd1199     GI: 42522734     BI number: Bd1199     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


            G
          A  t
          T  t
           Cg
           At
           At
           Gt
          |  c
          A  a
           At
           Gt
           At
           At
           Cg
           Ta
           At
          |  a
          |  t
          |  t
          |  c
          |  t
          |  g
          |  a
          |  a
           Cg
           At
           At
           Tg        ta
 GA       |  t      c  a
T  A      |  c       ta
 TG       |  a       gc
 TG       |  a       gc
 CG       T  a       gc
 GC       C  a       ta
 GC        Cg        ta
 AT        Gc        tg
 GT        Gc        cg
A  A       Gc        cg
C  A       At        cg
G  |       At        gc
 GC       G  t       at
 TA       T  g       at
 AT        Tg        at
 GC        Tg        at
                        ttttgtggctactttagtttggaaaacagtttttcatcatttttccggttaatcctcaataaaactgttccacgagccgataagtgtgtcagaagcgaacccatttgaacgtctatcggggtcaaggaatcATG


    ..................................................................................................................