                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-22.80 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G=-16.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgataaaaatcaaatcggctttggcggcgcaaaactcgatcccctccagcatcagggggcgttcatccggaaccaccaggtgtgccttggtggtcattc
ccagatctttgagttttttggaaatccaggaggcatttttgtttactatctgaccgtcggtcagctcggttccaatgcccaatacagcggctttcatatt
ctgcggtctccctcgaagaaatttaaggtattccacccccggatttgcgtccagaaccaatgccgggccccttgttaaatggcacagatgcgacgcatta
TTG

    Bd1201 --- spoU --- Bd1204 --- Bd1205 Gene: Bd1201     GI: 42522736     BI number: Bd1201     GOG: COG1960     Description: isovaleryl-CoA dehydrogenase Gene: spoU     GI: 42522737     BI number: Bd1203     GOG: COG0566     Description: putative RNA methylase Gene: Bd1204     GI: 42522738     BI number: Bd1204     GOG: NOG14544     Description: Protein-tyrosine phosphatase 2 Gene: Bd1205     GI: 42522739     BI number: Bd1205     GOG: -------     Description: conserved hypothetical protei            gt           t  g            gc            gc           |  t            at            cg            cg            at gc        cg a  a       cg c  t       at c  c      |  c ta       |  a cg       |  t cg        at cg        gc cg        gc tg       c  c a  |      c  a gc       t  | cg       a  | t  t       cg c  t       ta a  c      t  | a  a      g  | a  t      c  | a  c      g  | c  |       gt gc        gc cg        gt |  g       gt |  a       at |  a       cg gc        ta        aa gc       |  g      a  t c  a      |  t       gc gc       |  t       gc gc       a  t       ta ta       c  t       tg tg        gt        tg tg        at        ta |  t       cg        tg cg        cg        tg gt        ta        gc                         atttttgtttactatctgaccgtcggtcagctcggttccaatgcccaatacagcggctttcatattctgcggtctccctcgaagaaatttaaggtattccacccccggatttgcgtccagaaccaatgccgggccccttgttaaatggcacagatgcgacgcattaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................