                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGGGGGCTCATCCGGCAGTTGGTAAaccaagctctcggggctgcgtcttggggaaaggctctttgccttacccgct
tcggacagtcctcgctcttggttttctgtggtggctgccgctgggtttttggtgttcgcttgcggaacttgcgagtaaggcaaagagcctttccccaagt
cgcagacgaggcctggctgacaacctaggattcgcctttttgcttaatgcctagccttgggtgtgttgaagtcgttttggctggtgtttggcagcggtaa
ttgattttttgagggaaatttATG

    Bd1209 --- Bd1210 Gene: Bd1209     GI: 42522743     BI number: Bd1209     GOG: COG3762     Description: conserved hypothetical protein Gene: Bd1210     GI: 42522744     BI number: Bd1210     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic   a a  g a  a cg gc gc at at t  t g  c a  c g  c                 ac c  |                g  a gc                 t  a ta        ga       c  c ta       a  c       gc cg       c  g       gt at       g  a       ta a  |       cg        cg g  |       tg        cg gc        gc       g  a cg       a  c       gt gc        at        at ta        cg        gc tg        cg        cg                         cctttttgcttaatgcctagccttgggtgtgttgaagtcgttttggctggtgtttggcagcggtaattgattttttgagggaaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3762 Predicted membrane protein ... can be seen here     ..................................................................................................................