Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGCTTACGTTCCCTGCCACGATGAAAAACGTCTGAACGTGAAGCAGGCAGAATTCT
TCGACAACGAGGAAGTCTGGAAAGCTCTGCAAGTCAGCGACAGCCCGGAAAACGGCGC
CTGGGACGGATAGtcgtcttcaagtcaggtaaatcctacaaaaccggctaccacagccggttttgtcgttttggtgttcgccatgaaattt
cgaacagttcgtccttcaaaaaggcttaaactcgggaaaacctcgcaattgacatatacatgtccaatttgagttggtaagtgtttttgccaaATG

    Bd1219 --- Bd1218


Gene: Bd1219     GI: 42522751     BI number: Bd1219     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica
Gene: Bd1218     GI: 42522750     BI number: Bd1218     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


            a
          a  a
          t  t
           gc
           gc
           at
 TA       c  |
A  G       ta
 Gt        gc
 Gc       a  a
 Cg       a  |
 At       c  |
 Gc        ta
 Gt        ta
|  t      c  a
|  c      t  c
|  a       gc         c
|  a       cg       c  a
|  g       tg       a  c
|  t       Gc        ta
 Gc        At        cg
 Ta        Ta        gc
 Cg       A  |       gc
 Cg        Gc        cg
 Gt        Gc        cg
                        ttttgtcgttttggtgttcgccatgaaatttcgaacagttcgtccttcaaaaaggcttaaactcgggaaaacctcgcaattgacatatacatgtccaatttgagttggtaagtgtttttgccaaATG


    ..................................................................................................................