Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-25.90 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-12.35 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAACCGGTGGACCGGATTACTTAAAACAGTACATGGAACCAGCGTGCGTGACTGAGA
ACACACTTCGTCGCGGCTTTGCTCCGGCGGAAGAATAGtcctcctcaaaaaaaagtatcatctcaaagagcc
cccggccgaaaccgggggctcttttttttaaacctgaccagtccgtgaacactccgggcaaagacttcactctggcaccagcgatccccccttatttacg
agctgagctggcccagcctgtgcaactgcagggccgttgaatacatcccctagcaacccgaaggacctttATG

    Bd1249


Gene: Bd1249     GI: 42522776     BI number: Bd1249     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


            A
          A  T
          G  A
          A  G
           At
           Gc
           Gc
          C  t
           Gc
           Gc
          |  t
          |  c
          |  a
          |  a
          |  a
          |  a
          |  a
          |  a
          |  a
          |  a
 CA       |  g
A  C      |  t
A  A      |  a
 GC       |  t
 AT       |  c
 GT       |  a
T  C      |  t
 CG       |  c
 AT       |  t
 GC       |  c
 TG       |  a       ga
 GC       |  a      c  a
 CG       C  a      c  a
G  |       Cg        gc
 TG        Ta        gc
 GC        Cg        cg
C  T       Gc        cg
 GT       |  c       cg
 AT       |  c       cg
 CG       T  c       cg
C  C      T  c       gc
A  |       Tg        at
 AT        Cg        gc
 GC        Gc        at
 GC        Gc        at
 TG        Cg        at
                        tttttaaacctgaccagtccgtgaacactccgggcaaagacttcactctggcaccagcgatccccccttatttacgagctgagctggcccagcctgtgcaactgcagggccgttgaatacatcccctagcaacccgaaggacctttATG


    ..................................................................................................................