                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTCGATGGCGCTTTGGAAATAGCCAAAAAGGTCTTTTTCATTCTCAAAAATCAGTCC
AGCAGCCTCATCCACCAAGATGAGTTCTTTTTCAGAGGAGGTGCTTGGTTTCTTCTTT
GCGCGGGTCTTTGTTTTCGCCATTCGTTTCGTATCCTTCACcttttcattattgagacaatcccttcagc
caacaactagaaaaaagacactcacgacggcccctgtcatagaagtacttttggtcttgcaactgtggacaatattcctcaccattcaacttaagacgtc
agcaggaggcgctcTTG

    Bd1270 Gene: Bd1270     GI: 42522794     BI number: Bd1270     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic            TC           T  A            TG            TA            TG            CG            TA            TG           G  G           A  T CC       G  G A  A      T  | C  A      A  | CG        GC TA        AT AT        AT CG        CG TA        CG CG        AT             TTCTTCTTTGCGCGGGTCTTTGTTTTCGCCATTCGTTTCGTATCCTTCACcttttcattattgagacaatcccttcagccaacaactagaaaaaagacactcacgacggcccctgtcatagaagtacttttggtcttgcaactgtggacaatattcctcaccattcaacttaagacgtcagcaggaggcgctcTTG     ..................................................................................................................