                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -6.44 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACCTCGCCACGATTCCTGCGTTTTGAACGCTATGAATACCGCTTCAGCGACTTCAA
AGACCTGCGGCAAAACGGCCAGTGGTGGGAACGCGTTCATTCAGGTTCTTACGGCCCC
GTGTTCGGCAGAGACGATGGGAACGGCGAGCCTGCTTAGaagatttttcagtctgtcttaagtttaatcca
ccataaacaaacaatgagatttcaaacttaaacgcgccagtgacgaaactggcgctcttttattttttgcggcctttcgttagaacttctccattcacaa
tcaaggagtttttATG

    Bd1273 Gene: Bd1273     GI: 42522797     BI number: Bd1273     GOG: -------     Description: hypothetical protei            ac           a  a           a  a           t  a tt       a  c t  c      c  a t  a      c  a tg        at at        cg gc       |  a at        cg |  g       ta at        at Gc        at |  t      |  t At       |  c Ta        ta Ta        ta Cg        ta Gt        gc T  t       at C  t       at C  a       ta G  a       ta A  t      c  | G  |       ta C  |       gc        cg Gc        tg       a  a Gc       c  c      g  a C  a       tg        ta A  |       gc        gc A  |      |  c       at G  |      |  a       cg Gc       |  g       cg Gc        at        gc Ta        cg        cg At        ta        gc                         tcttttattttttgcggcctttcgttagaacttctccattcacaatcaaggagtttttATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.90 kcal/mol Antiterminator: Size=67 nt.     Delta G= -6.44 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -5.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAACCTCGCCACGATTCCTGCGTTTTGAACGCTATGAATACCGCTTCAGCGACTTCAA AGACCTGCGGCAAAACGGCCAGTGGTGGGAACGCGTTCATTCAGGTTCTTACGGCCCC GTGTTCGGCAGAGACGATGGGAACGGCGAGCCTGCTTAGaagatttttcagtctgtcttaagtttaatcca ccataaacaaacaatgagatttcaaacttaaacgcgccagtgacgaaactggcgctcttttattttttgcggcctttcgttagaacttctccattcacaa tcaaggagtttttATG     Bd1273 Gene: Bd1273     GI: 42522797     BI number: Bd1273     GOG: -------     Description: hypothetical protei            ac           a  t           a  t           c  a           t  a           t  a           t  c            ag ca        gc c  c      |  g t  c       ac a  a       gc at        ta ta        ag ta       |  t ta       |  g gc        aa a  a       cc a  a       ag t  |       a t  |       a c  |       c ta        a gc        a ta       a  | c  a       t t  |       a        cg g  |       c       a  a at       c        g  a cg        a        ta ta        c        gc tg       |         at ta       |         cg t  t      |         cg t  t       c        gc at        t        cg gc        a        gc                         tcttttattttttgcggcctttcgttagaacttctccattcacaatcaaggagtttttATG     ..................................................................................................................