                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgccgttggacgatcttctttattattgcacttgtgactggcgctgtggaactcggtttcacgctctctgcagcccctcttcccttgctggtgatcagct
tgcttgtgctgtgctttttgagtctacggtgcggtattgttggtgactttttctgtttttgatttgttctgttaaggactttaggggcgggttttgtaat
caagattatttcacacctttagtgcttaggtttctttggggtcgacccgataaatttggccatcgctggggaatgcgatggcttttgtcgggggagaata
ATG

    Bd1340 Gene: Bd1340     GI: 42522860     BI number: Bd1340     GOG: -------     Description: putative methyl accepting chemotaxis protei             c           t  g           g  a            gc            gc            gc ta        tg t  g       ta cg       t  t gt       c  | |  t       ta        gg t  t       ta       g  a gc        ta       g  a at        gt       t  t t  t       gt        cg t  t       at        gc tg        tg        cg cg        tg        ta cg       c  c       at a  |       gc        cg cg        ta        cg at        gt        gc                         ttttgtcgggggagaataATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-12.30 kcal/mol Antiterminator: Size=47 nt.     Delta G= -4.70 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G=-15.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tgccgttggacgatcttctttattattgcacttgtgactggcgctgtggaactcggtttcacgctctctgcagcccctcttcccttgctggtgatcagct tgcttgtgctgtgctttttgagtctacggtgcggtattgttggtgactttttctgtttttgatttgttctgttaaggactttaggggcgggttttgtaat caagattatttcacacctttagtgcttaggtttctttggggtcgacccgataaatttggccatcgctggggaatgcgatggcttttgtcgggggagaata ATG     Bd1340 Gene: Bd1340     GI: 42522860     BI number: Bd1340     GOG: -------     Description: putative methyl accepting chemotaxis protei   t t  t tg         t ta       t  t cg       t  c gt       t  t |  c       cg |  t       at        tt ta        gt       g  a gc       t  t       ta tg        gt        cg cg        gt        tg g  t       tg        ta t  g       ta        gc gc        gt       t  t tg       t  |      t  | t  |      t  |      t  | cg       a  |       at gt       t  |       gt ta        gt        ta |  t       gt        tg t  t       cg        tg cg        gt        tg gt       t  t       tg at        gc        gc cg        gt        tg tg        cg        cg at        at        tg                         ttttgtaatcaagattatttcacacctttagtgcttaggtttctttggggtcgacccgataaatttggccatcgctggggaatgcgatggcttttgtcgggggagaataATG     ..................................................................................................................