                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cagtaccggcaatatgaaggtcaatcctatcacccaaagggttttgcgacgtacttctctttctgcgatctcggaatcctgaggcgtgtccatatcagtc
ctttacaaaagacaggtctaatttcgaggaattgtaacgacaccactacaggaagacaaataaaaagcccccttgaaggtctgatgtgtgcacacaaaat
gttgctgtcactcagcaggagccttaagttcggctcgtattttcttattaggcgcaataaacagttcatcaggaactcagcaaccgtaaaggaacaaccg
ATG

    Bd1352 Gene: Bd1352     GI: 42522871     BI number: Bd1352     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic cc c  c       at gc       a  g at        at at        at a  g       cg a  a      |  c a  a       at t  g       cg a  |       at a  |      c  | a  |       gc cg        ta at        gc gc       t  t at        gc a  g       ta g  a      a  g       ag g  |       gc       a  t at        ta       t  t cg        cg       t  c at       |  g       cg t  |      |  a       cg cg        tg        gc at        gc        at cg        gc        gc                         gtattttcttattaggcgcaataaacagttcatcaggaactcagcaaccgtaaaggaacaaccgATG     ..................................................................................................................