                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gttacaattcctcgaaattagacctgtcttttgtaaaggactgatatggacacgcctcaggattccgagatcgcagaaagagaagtacgtcgcaaaaccc
tttgggtgataggattgaccttcatattgccggtactgatcactttgtgcggcatctattacgtcgtgtccactgggaaatagttctgttaaatcctccg
accgagcttttggtgtgaacacaacaacgacgatgtccgtaaatggccagtattttaagttgaaatatcttagcctgccttggatcaaccaggaggtttt
ATG

    Bd1353 Gene: Bd1353     GI: 42522872     BI number: Bd1353     GOG: -------     Description: putative oxidoreductas at g  g c  t a  c gc cg at         a a  a      a  a c  a      g  t a  a      t  a a  |      t  t c  |       gc at        at cg        at a  g       ta a  c       tg gc       t  c ta       t  c        c |  g       at       t  a gt        tg       a  a ta        gc        gc gt       |  c       gc gt       |  t      t  | t  t       at        ta t  t       cg        cg ta        cg        cg ta       |  a      g  | cg        gt        ta gt        gc        cg at        ta        cg                         ttttATG     ..................................................................................................................